View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20976_low_18 (Length: 279)
Name: NF20976_low_18
Description: NF20976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20976_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 28939400 - 28939228
Alignment:
| Q |
1 |
ttgttagattatgagatgatttttctctcttttaatctaacagtatatagtcgggtgcaccatagtggtgattgtggaggattcagttcgatgatttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28939400 |
ttgttagattatgagatgatttttttctcttttaatctaacagtctatagtcgggtgcaccatagtggtgattatggaggattcagttcgatgatttttt |
28939301 |
T |
 |
| Q |
101 |
atatgaacatgtacttgaatttctccataaaatttatacaaataataatcctagtaacttcttaggcctcaac |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28939300 |
atatgaacatgtacttgaatttctccataaaatttatacaaataataatcctagtaacttctcaggcctcaac |
28939228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 201 - 273
Target Start/End: Complemental strand, 28939203 - 28939131
Alignment:
| Q |
201 |
tgcatgtgtatttaaccctcatgcactaagctaccctttgttttgagtttattattactaatccaattttctt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28939203 |
tgcatgtgtatttaaccctcatgcactaagctaccctttgttttgagtttattattactaatccaattttctt |
28939131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University