View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20977_high_12 (Length: 224)

Name: NF20977_high_12
Description: NF20977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20977_high_12
NF20977_high_12
[»] chr3 (1 HSPs)
chr3 (18-204)||(41254774-41254957)


Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 41254774 - 41254957
Alignment:
18 aaacactactaatgtaggtaactaccctgtagcatgagttacaacatgaaacttccatgtatgctaagttatttacttccatatcacccaactatatcat 117  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
41254774 aaacaccactaatgtaggtaactaccctgtagcatgagttacaacatgaaacttccatgtatgctaagttatttacttccatatcaaccaactatatcat 41254873  T
118 gcataaccatattattatgggaatacgtcttcgtgcgcgttctgaacttagttagctaatatgatcttgtccatactatcgagttga 204  Q
    |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||   |||||||||||||| | |||||||    
41254874 gcataaccatattattatgggaatacgtcttcgtgcgcattctggacttagttagctaat---atcttgtccatacttttgagttga 41254957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University