View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20977_low_14 (Length: 224)
Name: NF20977_low_14
Description: NF20977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20977_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 41254774 - 41254957
Alignment:
| Q |
18 |
aaacactactaatgtaggtaactaccctgtagcatgagttacaacatgaaacttccatgtatgctaagttatttacttccatatcacccaactatatcat |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41254774 |
aaacaccactaatgtaggtaactaccctgtagcatgagttacaacatgaaacttccatgtatgctaagttatttacttccatatcaaccaactatatcat |
41254873 |
T |
|
| Q |
118 |
gcataaccatattattatgggaatacgtcttcgtgcgcgttctgaacttagttagctaatatgatcttgtccatactatcgagttga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||| | ||||||| |
|
|
| T |
41254874 |
gcataaccatattattatgggaatacgtcttcgtgcgcattctggacttagttagctaat---atcttgtccatacttttgagttga |
41254957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University