View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20978_high_6 (Length: 365)
Name: NF20978_high_6
Description: NF20978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20978_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 18 - 361
Target Start/End: Complemental strand, 8934136 - 8933794
Alignment:
| Q |
18 |
ataacattctttttctgaagaccttttctccttgatttcactgccttcattttaattggagttctatttagtaactcatccaatgagttcaaaattctga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8934136 |
ataacattctttttctgaagaccttttctccttgatttcactgccttcattttaattggagttctatttagtaactcatccaatgagttcaaaattctga |
8934037 |
T |
 |
| Q |
118 |
gtccattatgtgtattggcttttctcatagaaccaagtttcattcgtgctgttttagactcacatgagatagttggtacattgacatggtagatatgaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8934036 |
gtccattatgtgtattggcttttctcatagaaccaagtttcattcgtgctgttttagactcacatgagatagttggtacattgacatggtagatatgaga |
8933937 |
T |
 |
| Q |
218 |
atttcttgatactatgttgcttgaagcagtcactgttgccattttttatactgnnnnnnnncaaatattcctctagaattagatttcaagtttcaacctc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8933936 |
atttcttgatactatgttgcttgaagcagtcactgttgccattttttatactg-aaaaaaacaaatattcctctagaattagatttcaagtttcaacctc |
8933838 |
T |
 |
| Q |
318 |
acacttgtgaaattattgtgtataactataaagtataatctacc |
361 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
8933837 |
acacttgtgaaattattatgtataactataaagtataaactacc |
8933794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University