View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20978_low_10 (Length: 299)
Name: NF20978_low_10
Description: NF20978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20978_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 11 - 178
Target Start/End: Original strand, 4055104 - 4055271
Alignment:
| Q |
11 |
cagagaaacaaagatattactgttatgcccttcactctcaaagtcaaaaagtgttgaacttgttacttgtgatgatnnnnnnnttgatcttggttccata |
110 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4055104 |
cagagaaacaaagatatcactgttatgcccttcactctcaaagtcaaaaagtgttgaacttgttacttgtgatgatgaaaaaattgatcttggttccata |
4055203 |
T |
 |
| Q |
111 |
gctatagcttttgggttagacccatcaacgttgaggttgaatggttactttataagtagaggagttga |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4055204 |
gctatagcttttgggttagacccatcaacgttgaggttgaatggttactttataagtagaggagttga |
4055271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 231 - 281
Target Start/End: Original strand, 4055324 - 4055374
Alignment:
| Q |
231 |
agaggtttgtctactgggaaaagtaaccatgatgctattgttgttactggc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4055324 |
agaggtttgtctactgggaaaagtaaccatgatgctattgttgttactggc |
4055374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University