View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20978_low_14 (Length: 254)
Name: NF20978_low_14
Description: NF20978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20978_low_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 77 - 254
Target Start/End: Original strand, 43505308 - 43505485
Alignment:
| Q |
77 |
ggaccatcccaagattgtttccattcccaacccacactgctgaccgaaccacgcactctaagcatctttcctttggaggactcatgtttgaaggttgtcg |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43505308 |
ggaccatcccaagattgtttccattcccaacccacactgttgaccgaaccacgcactctaagcatctttcctttggaggactcatgtttgaaggttgtcg |
43505407 |
T |
 |
| Q |
177 |
actgtcacgagattttgacttagctcagttagaactagaaggctttagtgacccgacattctaatacttggatggcac |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43505408 |
actgtcacgagattttgacttagctcagttagaactagaaggctttagtgacccgacattctaatacttggatggcac |
43505485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University