View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20978_low_15 (Length: 248)

Name: NF20978_low_15
Description: NF20978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20978_low_15
NF20978_low_15
[»] chr4 (1 HSPs)
chr4 (1-231)||(38198443-38198674)


Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 38198443 - 38198674
Alignment:
1 ggacactgaattcatcatttttgcaagtgatggtctatggaaggtacgaggatacttcgtttatgctagaattatcaactt-cagtaattatcaacttaa 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||    
38198443 ggacactgaattcatcatttttgcaagtgatggtctatggaaggtacgaggatactttgtttatgctagaattatcaactttctgtaattatcaacttaa 38198542  T
100 aacttaggttcactattgcaggtgatgacgaatcaagaggcttgtgaatgtatcaaggatgttgatgatgctcaaaaagcagctacaaagttagtcaaag 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
38198543 aacttaggttcactattgcaggtgatgacgaatcaagaggcttgtgactgtatcaaggatgttgatgatgctcaaaaagcagctacaaagttagtcaaag 38198642  T
200 aagccaaatctcttggaagctgtgacgatatt 231  Q
    ||||||||||||||||||||||||||||||||    
38198643 aagccaaatctcttggaagctgtgacgatatt 38198674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University