View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20978_low_15 (Length: 248)
Name: NF20978_low_15
Description: NF20978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20978_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 38198443 - 38198674
Alignment:
| Q |
1 |
ggacactgaattcatcatttttgcaagtgatggtctatggaaggtacgaggatacttcgtttatgctagaattatcaactt-cagtaattatcaacttaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
38198443 |
ggacactgaattcatcatttttgcaagtgatggtctatggaaggtacgaggatactttgtttatgctagaattatcaactttctgtaattatcaacttaa |
38198542 |
T |
 |
| Q |
100 |
aacttaggttcactattgcaggtgatgacgaatcaagaggcttgtgaatgtatcaaggatgttgatgatgctcaaaaagcagctacaaagttagtcaaag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38198543 |
aacttaggttcactattgcaggtgatgacgaatcaagaggcttgtgactgtatcaaggatgttgatgatgctcaaaaagcagctacaaagttagtcaaag |
38198642 |
T |
 |
| Q |
200 |
aagccaaatctcttggaagctgtgacgatatt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38198643 |
aagccaaatctcttggaagctgtgacgatatt |
38198674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University