View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20978_low_16 (Length: 246)
Name: NF20978_low_16
Description: NF20978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20978_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 10 - 167
Target Start/End: Original strand, 32513195 - 32513352
Alignment:
| Q |
10 |
attatactttgtacttaccagcttagttaagctcacgtggataattatagatcatttgattgcataaaatcatggattgagatattgatctatacatata |
109 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32513195 |
attatacattgtacttaccagctgagttaagctcacgcggataattatagatgatttgattgcataaaatcatggattgaggtattgatctatacatata |
32513294 |
T |
 |
| Q |
110 |
ttttcataaagattttagttgattttatatttgtcatgtataagcacaaaaaggaaag |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32513295 |
ttttcataaagattttagttgattttatatttgtcatgtataagcacaaaaaggaaag |
32513352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University