View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20978_low_17 (Length: 239)
Name: NF20978_low_17
Description: NF20978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20978_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 32513582 - 32513800
Alignment:
| Q |
1 |
caaagaatatgcaacggcaaactctactccttttaagcttttctttattcccatttccaacagcaacactactttggattcttgtcaataacctatttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
32513582 |
caaagaatatgcaacggcaaactctactccttttaagcttttctttattcccatttctaacagcaacactactttggattcttgtcgattacctatttct |
32513681 |
T |
 |
| Q |
101 |
ttaaccaatagtattatatatttaaggtcttggcaaccag--ctccggcttgtgtcctcgagacactagttaagatagtaaagaaaaagcaagttttaag |
198 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
32513682 |
ttaaccaatagtattatatatttaagatcttggcaaccagttctccggcttgtgtcctcgagacaccggttaagatagtaaagaaaaagcaaattttaag |
32513781 |
T |
 |
| Q |
199 |
ctg-aaaaaacactttttt |
216 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
32513782 |
ttgaaaaaaacactttttt |
32513800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University