View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20978_low_18 (Length: 237)
Name: NF20978_low_18
Description: NF20978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20978_low_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 43505713 - 43505492
Alignment:
| Q |
16 |
ataccgtgctcgcattgtagtgtttattgtttaggttgaatgaatgacttgattttctcttggtggttctctccttttaagtcagaggtttccttctagt |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43505713 |
atacagtgctcgcattgtagtgtttattgtttaggttgaatgaatgacttgattttctcttggtggttctctccttttaagtcacaggtttccttctagt |
43505614 |
T |
 |
| Q |
116 |
ccggtggatatcttgcgccatattttaaggatatttggctagggattctttaacacaaccatgtactcgctattttactcagaccctattcggattggtc |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43505613 |
ccggtggatatctcgcgccatattttaaggatatttggctagggattctttaacacaaccatgtagtcgctattttactcagaccctattcggattggtc |
43505514 |
T |
 |
| Q |
216 |
agtcccggatcatgtcgagtac |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43505513 |
agtcccggatcatgtcgagtac |
43505492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University