View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20978_low_5 (Length: 427)
Name: NF20978_low_5
Description: NF20978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20978_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 2e-62; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 18 - 160
Target Start/End: Complemental strand, 47619087 - 47618945
Alignment:
| Q |
18 |
cactgggctcaagctgttgcttgttcagtaatgcaatctcattcatgatgaagtcaagtgtgggatacatacatcataaatatgttctgcttttctttcn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619087 |
cactgggctcaagctgttgcttgttcagtaatgcaatctcattcatgatgaagtcaagtgtgggatacatacatcataaatatgttctgcttttctttct |
47618988 |
T |
|
| Q |
118 |
nnnnnngtacagagggagggtggttctcattctagatatatgc |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47618987 |
ttttttgtacagagggagggtggttctcattctagatatatgc |
47618945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 218 - 331
Target Start/End: Complemental strand, 47618886 - 47618773
Alignment:
| Q |
218 |
tgtgcagattttcttgagggtttttgttggggctgaacaaacaaacacatttggttggttggctccaatttgtaaattggtagaaggttatggtgtcatc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47618886 |
tgtgcagattttcttgagggtttttgttggggctgaacaaacaaacacatttggttggttggctccaatttgtaaattggtagaaggttatgctgtcatc |
47618787 |
T |
|
| Q |
318 |
aaatatttgcacca |
331 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47618786 |
aaatatttgcacca |
47618773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 374 - 417
Target Start/End: Complemental strand, 47618730 - 47618687
Alignment:
| Q |
374 |
caattggattggatgtggaactgtctctccgaggagctattcat |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47618730 |
caattggattggatgtggaactgtctctccgaggagctattcat |
47618687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University