View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20979_low_11 (Length: 247)
Name: NF20979_low_11
Description: NF20979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20979_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 15 - 229
Target Start/End: Original strand, 44494537 - 44494750
Alignment:
| Q |
15 |
aatatattgatagagattaattctttaaacaaatccttgacattttgttatattcatttccacaattgaacatggtccttggagattggagacatgttag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44494537 |
aatatattgatagagattaattctttaaacaaatccttgacattttgttatattcatttccacaattgaacatggtccttggagattggagacatgttag |
44494636 |
T |
 |
| Q |
115 |
tttactnnnnnnncttttttcttcatggctttattcatcaaaattatttatgtgtacgtttttgttttcttcctattatgtgaccttaaatagtgtgtta |
214 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44494637 |
tttactaaaaaaacttttttcttcatggctttattcatcaaaattatttatgt-tacgtttttgttttcttcctattatgtgaccttaaatagtgtgtta |
44494735 |
T |
 |
| Q |
215 |
tagatttgtgataca |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44494736 |
cagatttgtgataca |
44494750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University