View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20979_low_13 (Length: 239)
Name: NF20979_low_13
Description: NF20979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20979_low_13 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0001 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 20 - 223
Target Start/End: Original strand, 505368 - 505571
Alignment:
| Q |
20 |
cattccatttaactctttaaccaattctgaagcagatttatcagaatcgttagaatttataaaatgggtcatcccaaaagcttctcctttttctctcttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
505368 |
cattccatttaactctttaaccaattctgaagcagatttatcagaatcattagaatttataaaatgggtcatcccaaaagcttctcctttttctctcttc |
505467 |
T |
|
| Q |
120 |
atctcgtttttgtcaaccccaattatcttacttgctcccatcatcttagccccgcttattgccttcaccacacgttttaaaaccgaagttcatgtcatta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
505468 |
atctcgtttttgtcaaccccaattatcttacttgctcccatcatcttagccccgcttattgccttcaccacacgttttaaaaccgaagttcatgtcatta |
505567 |
T |
|
| Q |
220 |
atga |
223 |
Q |
| |
|
|||| |
|
|
| T |
505568 |
atga |
505571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 33 - 163
Target Start/End: Original strand, 20051363 - 20051493
Alignment:
| Q |
33 |
tctttaaccaattctgaagcagatttatcagaatcgttagaatttataaaatgggtcatcccaaaagcttctcctttttctctcttcatctcgtttttgt |
132 |
Q |
| |
|
||||||||||| || |||||||| |||| ||| | | | ||||||||| |||||||| || ||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
20051363 |
tctttaaccaaatcagaagcagacttatatgaaccacttggatttataaagtgggtcattccgaaagcttctcctttttctctcttcatctcatttttat |
20051462 |
T |
|
| Q |
133 |
caaccccaattatcttacttgctcccatcat |
163 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
20051463 |
caaccccaattattttacttgctcccatcat |
20051493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University