View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20979_low_3 (Length: 408)
Name: NF20979_low_3
Description: NF20979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20979_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 340 - 398
Target Start/End: Complemental strand, 4715451 - 4715393
Alignment:
| Q |
340 |
aaattttattgccaccacaatctatggctccaccaataatataaaagctactgatgatg |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4715451 |
aaattttattgccaccacaatctatggctccaccaataatataaaagctactcatgatg |
4715393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 251 - 288
Target Start/End: Original strand, 41043216 - 41043253
Alignment:
| Q |
251 |
tgatcattttgactctttatagagtcaatggcagcttg |
288 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
41043216 |
tgattattttgactctttatagaatcaatggcagcttg |
41043253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University