View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2097_high_19 (Length: 356)

Name: NF2097_high_19
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2097_high_19
NF2097_high_19
[»] chr2 (1 HSPs)
chr2 (169-274)||(7307909-7308014)
[»] chr6 (1 HSPs)
chr6 (8-46)||(13245400-13245438)


Alignment Details
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 169 - 274
Target Start/End: Original strand, 7307909 - 7308014
Alignment:
169 aatctcaacttaccatacacatacgaggatcctaacactattcataatagaggcaacatgacaacttcgaattactcaatcaccatttccataataacag 268  Q
    |||||||||  ||||||||||||| ||||||| ||||| |||||||| ||||||||   ||||||||||| |||||||||||||||||| | ||||| ||    
7307909 aatctcaaccaaccatacacatacaaggatcccaacaccattcataacagaggcaatgagacaacttcgatttactcaatcaccatttctacaataaaag 7308008  T
269 attgat 274  Q
     |||||    
7308009 cttgat 7308014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 46
Target Start/End: Original strand, 13245400 - 13245438
Alignment:
8 catagggaattaagactaaccccacaaatacagggatgg 46  Q
    |||||||||||||||||||||||||||| ||||||||||    
13245400 catagggaattaagactaaccccacaaacacagggatgg 13245438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University