View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_high_32 (Length: 287)
Name: NF2097_high_32
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 19 - 278
Target Start/End: Complemental strand, 32956554 - 32956295
Alignment:
| Q |
19 |
gctaccccttccacacgtttatctgaagaccaagataaacgaaaccgtcgctcttctcttgctaattttttctgtaccaaatcttcaaacactaaacata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32956554 |
gctaccccttccacacgtttatctgaagaccaagataaacgaaaccgtcgctcttctcttgctaattttttctgtaccaaatcttcaaacactaaacata |
32956455 |
T |
 |
| Q |
119 |
attctcaatctcaatccaagtcaaacaatattggtagtaactctaacaatgattctcttcttgctcgtcgatgtgctagctgtgactccacttctacacc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32956454 |
attctcaatctcaatccaagtcaaacaatattggtagtaactctaacaatgattctcttcttgctcgtcgttgtgctagctgtgactccacttctacacc |
32956355 |
T |
 |
| Q |
219 |
cctttggaggaatggtcctcgtggccctaaggtaaaaatacattaccaataccacctttg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32956354 |
cctttggaggaatggtcctcgtggccctaaggtaaaaatacattaccaataccatctttg |
32956295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 163 - 256
Target Start/End: Original strand, 7723517 - 7723610
Alignment:
| Q |
163 |
aacaatgattctcttcttgctcgtcgatgtgctagctgtgactccacttctacacccctttggaggaatggtcctcgtggccctaaggtaaaaa |
256 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| | ||||||| |||| || ||||| ||||||||||| || ||||| ||||| |||||||||| |
|
|
| T |
7723517 |
aacaatgattctcttcttgctcgtagatgtgcaaactgtgacaccacctccacaccgctttggaggaacggccctcgaggcccaaaggtaaaaa |
7723610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University