View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_high_34 (Length: 282)
Name: NF2097_high_34
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_high_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 258
Target Start/End: Original strand, 31303123 - 31303361
Alignment:
| Q |
20 |
ttaaatcgttgggtcaaatattgtggtcggagtttgaactccaactcctttacttgtgtgtctaagttttaaaagctattgtaattttgtcaatctatca |
119 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31303123 |
ttaaatcgttgggtcaaatgtcgtggtcggagtttgaactccaactcctttacttgtgtgtctaagttttaaaagctattgtaattttgtcaatctttca |
31303222 |
T |
|
| Q |
120 |
gaaataaaattgatgtagttggtttaaattttaaaccaaatatatcaactagttttgatcaatcaaggacgagccaagtaatcattgttcaaaatttaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31303223 |
caaataaaattgatgtagttggtttaaattttaaaccaaatatatcaactagttttgatcaatcaaggacgagccaagtaatcattgttcaaaatttgga |
31303322 |
T |
|
| Q |
220 |
attgtcacttttctaatcaataatacatgaataaagatt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31303323 |
attgtcacttttctaatcaataatacatgaataaagatt |
31303361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University