View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_high_46 (Length: 255)
Name: NF2097_high_46
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_high_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 85 - 245
Target Start/End: Original strand, 41787380 - 41787540
Alignment:
| Q |
85 |
atttgcagatattgttttgaaccatagggaaggtatgttttcacttgagaatcaccagtcaacaaaagcagcaacagaagtccagaatgatatgattctt |
184 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787380 |
atttgcagatcttgttttgaaccatagggaaggtatgttttcacttgagaatcaccagtcaacaaaagcagcaacagaagtccagaatgatatgattctt |
41787479 |
T |
 |
| Q |
185 |
cctcaagaatggacatactgaagttactgtagagccacatgcatttgcaactagtcctatg |
245 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787480 |
cctcaagaatggacatattgaagttactgtagagccacatgcatttgcaactagtcctatg |
41787540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 41787273 - 41787356
Alignment:
| Q |
1 |
tatagtattgaactgacagttattgattatgaatataaaactatctaatttgattttcatctattttttgtgaatcaatttgct |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787273 |
tatagtattgaactgacagttattgattatgaatataaaactatctaatttgattttcatctattttttgtgaatcaatttgct |
41787356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University