View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_high_50 (Length: 250)
Name: NF2097_high_50
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_high_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 5012344 - 5012567
Alignment:
| Q |
1 |
atccttccgaagaggaggaaaatggtaccttaggatcaactgaagatgaaaatgaggatgaaatggtagatgatgatgatactggtttttctacctgaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5012344 |
atccttccgaagaggaggaaaatggtaccttaggatcaattgaagatgaaatggtagatga---------tgatgatgatactggtttttctacctgaga |
5012434 |
T |
 |
| Q |
101 |
tgatatttttgtaacaaaagattgaggggtgcactaagtaatgtctaataacctatttcagttttcaaaaggtttgcctccctttaactatatgttagta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012435 |
tgatatttttgtaacaaaagattgaggggtgcactaagtaatgtctaatcaactatttcagttttcaaaaggtttgcctccctttaactatatgttagta |
5012534 |
T |
 |
| Q |
201 |
cctactttttgtaaaagtttcttgcatctagtt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5012535 |
cctactttttgtaaaagtttcttgcatctagtt |
5012567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University