View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_high_59 (Length: 239)
Name: NF2097_high_59
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_high_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 31 - 221
Target Start/End: Complemental strand, 46146773 - 46146583
Alignment:
| Q |
31 |
ggctaatgaatggaacatatgtatgtagattgctgtgaagcggttgaagacaatgactgcaaaagcagagatggaatttgcagttgaagtggaagtacta |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46146773 |
ggctaatgaatggaacatatgtatgtagattgctgtgaagcggttgaagacaatgactgcaaaagcagagatggaatttgcagttgaagtggaagtacta |
46146674 |
T |
 |
| Q |
131 |
ggaagggtgaggcataagaatttgttaggattgagggggttctatgcaggaggagatgaaaggttaattgtgtatgattacatgcctaatc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46146673 |
ggaagggtgaggcataagaatttgttaggattgagggggttctatgcaggaggagatgaaaggttaattgtgtatgattacatgtctaatc |
46146583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 90 - 159
Target Start/End: Complemental strand, 53682821 - 53682752
Alignment:
| Q |
90 |
caaaagcagagatggaatttgcagttgaagtggaagtactaggaagggtgaggcataagaatttgttagg |
159 |
Q |
| |
|
|||| ||||||||||||||||| || ||||| ||||| || |||||||| ||||| || ||||||||||| |
|
|
| T |
53682821 |
caaaggcagagatggaatttgctgtagaagttgaagtgcttggaagggttaggcacaaaaatttgttagg |
53682752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University