View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_high_62 (Length: 237)
Name: NF2097_high_62
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_high_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 73 - 221
Target Start/End: Complemental strand, 39735057 - 39734910
Alignment:
| Q |
73 |
ccacaaggatttaatatgaggaannnnnnncttcttccaactagcatcatgcttttaatattttagtacagnnnnnnnnnnnnnnttgttctctatgagg |
172 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39735057 |
ccacaaggatttaatatgaggaatttttttcttcttccaactagcatcatgcttttaatattttagtacagtttttaaaaaaaa-ttgttctctatgagg |
39734959 |
T |
|
| Q |
173 |
atgcatcgaaaataatgattttcctatcggcacttcacaaacaaaactt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39734958 |
atgcatcgaaaataatgattttcctatcggcacttcacaaacaaaactt |
39734910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 141
Target Start/End: Complemental strand, 38967795 - 38967755
Alignment:
| Q |
103 |
cttcttccaact--agcatcatgcttttaatattttagtac |
141 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38967795 |
cttcttccaactggagcatcatgcttttaatattttagtac |
38967755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University