View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_high_69 (Length: 227)
Name: NF2097_high_69
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_high_69 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 23007445 - 23007245
Alignment:
| Q |
17 |
ataaacttataagatcaatgagaaagacatgttaaacaatgagatatatgattaagagggagttaagatacagtactcttatatatgtaacctactggaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
23007445 |
ataaacttataagatcaatgagaaagacatgttaaacaatgagatatatgattaagagggagttaagatacaatactcttatatatgtcacctactggaa |
23007346 |
T |
|
| Q |
117 |
gatcagtatctagacattcaacacaaacctagtgaagtccagagtgca----nnnnnnnnggataattgtgtaaactaaatttagtccaagtcacccttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23007345 |
gatcagtatctagacattcaacacaaacctagtgaagtccagagtgcattttttttttttggataattgtgtaaactaaatttagtccaagtcacccttt |
23007246 |
T |
|
| Q |
213 |
g |
213 |
Q |
| |
|
| |
|
|
| T |
23007245 |
g |
23007245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University