View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_high_80 (Length: 201)
Name: NF2097_high_80
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_high_80 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 9321897 - 9322087
Alignment:
| Q |
1 |
taccggtaagcgggagaggatttcctccaacaattccggcggaggaacatcactcgccattggaaggaaggttcgttctagggttgtgtggtgcttctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9321897 |
taccggtaagcgggagaggatttcctccaacaattccggcggaggaacatcactcgccattggaaggaaggttcgttctagggttgtgtggttcttctgc |
9321996 |
T |
|
| Q |
101 |
gttttggttgatttaggttttagtatttgttgattgattgtcaccatccactaatcattctgctaccgctaccaagaaatagagtgagcgttgtttcctt |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9321997 |
g----------tttaggttttagtatttgttgattgattgtcaccatccactaatcattctgctactgctaccaagaaatagagtgagcgttgtttcctt |
9322086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 9329505 - 9329642
Alignment:
| Q |
1 |
taccggtaagcgggagaggatttcctccaacaattccggcggaggaacatcactcgccatt----ggaaggaaggttcgttctagggttgtgtggtgctt |
96 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| || ||||||||| ||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
9329505 |
taccggtaagcgggagaggatttccgttaacaattccggcagaagaacatcacccgccattggaaggaaggaaggttcgttctagggttgtgtggaactg |
9329604 |
T |
|
| Q |
97 |
ctgcgttttggttgattta-ggttttagtatttgttga |
133 |
Q |
| |
|
|| |||||||||||||||| ||||||||| |||||||| |
|
|
| T |
9329605 |
ctacgttttggttgatttagggttttagtttttgttga |
9329642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 2 - 71
Target Start/End: Complemental strand, 9060340 - 9060271
Alignment:
| Q |
2 |
accggtaagcgggagaggatttcctccaacaattccggcggaggaacatcactcgccattggaaggaagg |
71 |
Q |
| |
|
|||||||||||||||| |||||| | | | |||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
9060340 |
accggtaagcgggagaagatttcggcaagtatttccggcggaagaacatcagccgccattggaaggaagg |
9060271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University