View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_13 (Length: 419)
Name: NF2097_low_13
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 17 - 409
Target Start/End: Original strand, 305035 - 305424
Alignment:
| Q |
17 |
gaaacttgtgatcaagcttcaaaatggcgaatttgttgaagctgttattatgagatatgatactcgtttgggtaaatatggtggtgaacctcgtcctggt |
116 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
305035 |
gaaacttgtcatcaagcttcaaaatggtgaatttgttgaagctgttattatgagatatgatactcgtttgggtaaatatggtggtgaacctcgtcctggt |
305134 |
T |
 |
| Q |
117 |
ggtctgagagctactttatgtatttcttctcaggttggatgcaaaatgggttgtaaattctgtgcaactggaagtatgggatttaaaagtaacttatcct |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
305135 |
ggtctaagagctactttatgtatttcttctcaggttggatgcaaaatgggttgtaaattctgtgcaactggaagtatgggatttaaaagtaacttatcct |
305234 |
T |
 |
| Q |
217 |
ctggtgaaattgtcgagcagttggttcatgcttctgtttttgcacatatacgtaatgttgtcttcatggtaattaaattctttttctatgcctctattca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
305235 |
ctggtgaaattgtcgagcagttggttcatgcttctgcttttgcacatatccgtaatgttgtcttcatggtaattaaattctttttctatgcctctattca |
305334 |
T |
 |
| Q |
317 |
ttcatgtttcataagacaatagtatttcattttctattttcttaatagggaatgggagagcctttgaacaactattctgctgtggttgaatct |
409 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
305335 |
t---agtttcataagacaatagtatttcattttctattttcttaatagggtatgggagagcctttgaacaactattctgctgtggtagaatct |
305424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University