View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_16 (Length: 389)
Name: NF2097_low_16
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 20 - 176
Target Start/End: Complemental strand, 38056581 - 38056425
Alignment:
| Q |
20 |
gcccttttatttagtttaatttttctttaaatgttttgtattgaaagatttggagaggaagatcgaaaccagaagaaaagcatttcttgaagctgccccc |
119 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38056581 |
gcccttttatttaatttaatttttctttaaatgttttgtattgaaagatttggagaggaagattgaaaccagaagaaaagcatttcttgaagctgccccc |
38056482 |
T |
 |
| Q |
120 |
atcatgagaaaaagtttctcaggtatatgacnnnnnnnatgcaatgtgtttatataa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38056481 |
atcatgagaaaaagtttctcaggtatatgactttttttatgcaatgtgtttatataa |
38056425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 266 - 368
Target Start/End: Complemental strand, 38056343 - 38056241
Alignment:
| Q |
266 |
gcatatttagtcaaaaacaatgttagcatatctgannnnnnnctttaaatgttaatattatgatattagcatatccgattttgcgccttttgtcaaacaa |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38056343 |
gcatatttagtcaaaaacaatgttagcatatctgatttttttctttaaatgttaatattatgatattagcatatccgattttgcgccttttgtcaaacaa |
38056244 |
T |
 |
| Q |
366 |
gac |
368 |
Q |
| |
|
||| |
|
|
| T |
38056243 |
gac |
38056241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University