View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_21 (Length: 356)
Name: NF2097_low_21
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 169 - 274
Target Start/End: Original strand, 7307909 - 7308014
Alignment:
| Q |
169 |
aatctcaacttaccatacacatacgaggatcctaacactattcataatagaggcaacatgacaacttcgaattactcaatcaccatttccataataacag |
268 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||| |||||||| |||||||| ||||||||||| |||||||||||||||||| | ||||| || |
|
|
| T |
7307909 |
aatctcaaccaaccatacacatacaaggatcccaacaccattcataacagaggcaatgagacaacttcgatttactcaatcaccatttctacaataaaag |
7308008 |
T |
|
| Q |
269 |
attgat |
274 |
Q |
| |
|
||||| |
|
|
| T |
7308009 |
cttgat |
7308014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 46
Target Start/End: Original strand, 13245400 - 13245438
Alignment:
| Q |
8 |
catagggaattaagactaaccccacaaatacagggatgg |
46 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13245400 |
catagggaattaagactaaccccacaaacacagggatgg |
13245438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University