View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_25 (Length: 342)
Name: NF2097_low_25
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 41280878 - 41281190
Alignment:
| Q |
1 |
ctggtcctaaactttgaattgtagcataaagccctagccaacaaccacgtagagagtcacctaaagtagcatcatttatgataatgagaatcacaaccac |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41280878 |
ctggacctaaactttgaattgtagcataaagccctagccaacaaccacgtagagagtcacctaaagtagcatcatttatgataatgagaatcacaaccac |
41280977 |
T |
 |
| Q |
101 |
gtatgaaaatgcagggaatgttattaggcttgtaattgaaataggtccataaagtgttgcacctgctactatggtgcaagctaaggcggttctaaatgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41280978 |
gtatgaaaatgcagggaatgttattaggcttgtaattgaaataggtccataaagtgttgcaccagctactatggtgcaagctaaggcggttctaaatgct |
41281077 |
T |
 |
| Q |
201 |
gaagagagacactctctccacaatggtggtatgttgaagaaactcaccataaggtttagtggtgatctctccattttggttttaatattttttgggtttg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41281078 |
gaagagagacactctctccacaatggtggaatgttgaagaaactcaccataaggtttagtggtgatctctccattttggttttaatattttttgggtttt |
41281177 |
T |
 |
| Q |
301 |
tgctagctgagga |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41281178 |
tgctagctgagga |
41281190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University