View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_35 (Length: 283)
Name: NF2097_low_35
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 52882413 - 52882144
Alignment:
| Q |
1 |
taggcttcatttttat-aaacaattatttaggctccatgtcatcaaaatgttatcttcatgatgttatgtgagttttttaacgagtggattgtagcaagc |
99 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52882413 |
taggcttcattttttttaaacaattatttaggcttcatgtcatcaaaatgttatcttcatgatgttatgtgagttttttaacgagtggattgtagcaagc |
52882314 |
T |
|
| Q |
100 |
cacggtttgatatattgaacctgtattatttgagtgaatgggattatctttacaata--nnnnnnngactaaagacaaatttatttatgttttggaatta |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52882313 |
cacggtttgatatattgaacctgtattatttgagtgaatgggattatctttacaatatttttttttgactaaagacaaatttatttatgttttggaatta |
52882214 |
T |
|
| Q |
198 |
gaggannnnnnnagggaaaaacagttaagataagttggatttcaaatgctagaatgatgagagcagaaag |
267 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52882213 |
gaggatttttttagggaaaaacagttaagataagttggatttcaaatgctagaatgatgagagcagaaag |
52882144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University