View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_38 (Length: 279)
Name: NF2097_low_38
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 22 - 268
Target Start/End: Original strand, 47558704 - 47558952
Alignment:
| Q |
22 |
tgaatgtgttaaactgtgtaatttaagaaagactt--aataattgattgatattatctatgtttacaagatgcatgctcctttttggaggtctagatttg |
119 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47558704 |
tgaatgtattaaactgtgtaatttaagaaagacttgtaataattgattgatattatctatgtttacaagatgcatgctcctttttggaggtctagattgg |
47558803 |
T |
|
| Q |
120 |
aataattacgtagtttggtgtacatgtgaaatgagtgatattcataaacgttttgcattgccaattttaatgatatggagtcttcggttatggggtttga |
219 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47558804 |
aataattacgtagtttggtgtacatatgagatgagtgatattcataaacgttttgcattgccaattttaatgatatggagtcttcggttatggggttcga |
47558903 |
T |
|
| Q |
220 |
acgtatgtgttgtcgtttgatggcgtgtgcgtgttacttatcatttctt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47558904 |
acgtatgtgttgtcgtttgatggcgtgtgcatgttacttatcatttctt |
47558952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University