View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_43 (Length: 266)
Name: NF2097_low_43
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 12641722 - 12641919
Alignment:
| Q |
1 |
gtggatagtagaaatccatcattatctttctcatttttgttt-ctgacttgggactttgttctttttctcaatttaatatgttttagagattgctcttta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||| ||||||||||||||||||||||| ||||| ||||||| |||| |
|
|
| T |
12641722 |
gtggatagtagaaatccatcattatctttctcattttttttttctgacttgggccttagttctttttctcaatttaatatggtttagggattgcttttta |
12641821 |
T |
|
| Q |
100 |
gactattagcaattgcttaaaaacacttcaaactaccgaaaatattcccaccggttgataactatcgtccggcagaaaaagtagttaactattgttcg |
197 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12641822 |
gaccattagcaattgcttaaaaacacttcaaactaccgaaaatattcccaccggttgataactaccgtccggcagaaaaagtagttaactattgttcg |
12641919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 248
Target Start/End: Original strand, 12641935 - 12641967
Alignment:
| Q |
216 |
aggtgtctgtgagtaattgataggtgactaaag |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
12641935 |
aggtgtctgtgagtaattggtaggtgactaaag |
12641967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University