View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_51 (Length: 251)
Name: NF2097_low_51
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_51 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 30551976 - 30551742
Alignment:
| Q |
29 |
ttttgaacaaaatgcttatgcttaaattattatgattcatatgcagaactcctttcaacttgcatttttcacttggagttgggtaagtagttaattacta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30551976 |
ttttgaacaaaatgcttatgcttaaattattatgattcatatgcagaactcctttcaacttgcatttttcacttggagttgggtaagtagttaattacta |
30551877 |
T |
|
| Q |
129 |
attaa-----tattggtgtgtgctcaatagatc--tagagatgttaaatttttta-----aatatggtgattctatactaactaataaacaacagtatga |
216 |
Q |
| |
|
||||| |||||||||||||| |||||||| |||||||||||| ||||| | ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30551876 |
attaatattatattggtgtgtgctgaatagatctatagagatgttaactttttaatatatgatatgatgattctatactaactaataaacaacagtatga |
30551777 |
T |
|
| Q |
217 |
atttggtccaaggtcttgcttcaatagagaaaaag |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30551776 |
atttggtccaaggtcttgcttcaatagagaaaaag |
30551742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University