View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_57 (Length: 249)
Name: NF2097_low_57
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 5012202 - 5012040
Alignment:
| Q |
1 |
tgtgatctacctttttgaggataactttttcaaagatgggtgatttactctcaaactgaggcttaatcggtgcaggttttttgccgtgagctagcggttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012202 |
tgtgatctacctttttgaggataactttttcaaagatgggtgatttactctcaaactgagtcttaatcggtgcaggttttttgccgtgagctagcggttg |
5012103 |
T |
 |
| Q |
101 |
agacacccataatgcattgatcggtgatagcttagcaggcctccctctctttcgtggttgtcc |
163 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012102 |
agacacccataatgaattgatcggtgatagcttagcaggcctccctctctttcgtggttgtcc |
5012040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 194 - 239
Target Start/End: Complemental strand, 5012039 - 5011994
Alignment:
| Q |
194 |
ttccattttatcttttttgagtgacgaaacttcttgttcaagtata |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012039 |
ttccattttatcttttttgagtgacgaaacttcttgttcaagtata |
5011994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University