View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_58 (Length: 249)
Name: NF2097_low_58
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 113 - 242
Target Start/End: Original strand, 29834599 - 29834718
Alignment:
| Q |
113 |
aaagagtgcattttctacggaagtaagtgaagcaattttagtcactgatcatgactaatcatgaaattgaccattgaataactttagccttgatcccatg |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29834599 |
aaagagtgcattttctacgggagtaagtgaagcaattttagtcact----------aatcatgaaattgaccattgaataactttagccttgatcccatg |
29834688 |
T |
|
| Q |
213 |
catgaatattgagtattcttttcctttgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29834689 |
tatgaatattgagtattcttttcctttgct |
29834718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 3 - 98
Target Start/End: Original strand, 29833174 - 29833269
Alignment:
| Q |
3 |
gaacggaggaagtaattattaacacttttcatttaaaataataaataataattaggttcgtgtggtgaatattttacaatccatgtatggtaaaga |
98 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||| ||||||||||| |
|
|
| T |
29833174 |
gaacggaggaagtaattattaacatttttcatttaaaataataaataataattaggttggtgtggtgaatattttagaaaccatatatggtaaaga |
29833269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University