View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_60 (Length: 244)
Name: NF2097_low_60
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 50679508 - 50679735
Alignment:
| Q |
1 |
taatttaatagcaaagaaactataaagatcatcaattttgttaattatgttccttttttcttttatttcaaaagagcctaacaatgagattcacattcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50679508 |
taatttaatagcaaagaaactataaagatcatcaattttgtaaattacgttccttttttcttttatttcaaaagagcctaacaatgagattcacattcac |
50679607 |
T |
 |
| Q |
101 |
taaatattgaagagtggaaattttttggtttaaacatgtgtctcatcattcatatcaaatgtccatataattttttactatttgatatgtactaaggaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50679608 |
taaatattgaagagtggaaattttttggtttaaacatgtgtctcatcattcatataaaatgtccatataactttttactatttgatatgtactaaggaat |
50679707 |
T |
 |
| Q |
201 |
aaagtattttctctttaattcataaaac |
228 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
50679708 |
taagtattttctctttaattcataaaac |
50679735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University