View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_61 (Length: 242)
Name: NF2097_low_61
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_61 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 3 - 169
Target Start/End: Complemental strand, 23258689 - 23258522
Alignment:
| Q |
3 |
taacatgtgggtttgaaagggatggagagccaaaaagagtaaattcctctgaatcatataataaccttgtatagtgacgcagcaatagatattttgataa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
23258689 |
taacatgtgggtttgaaagggatggagagccaaaaatagtaaattcctctgaatcatataataaccttgtatagtgacgcagc-gtagatattttcataa |
23258591 |
T |
 |
| Q |
103 |
catgcct--taaaataaaataaaatagaaagaggatattttaataaccttgttcattttgagccaagtg |
169 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23258590 |
catgccttataaaataaaataaaatagaaagaggatattttgataaccttgttcattttgagccaagtg |
23258522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University