View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_62 (Length: 240)
Name: NF2097_low_62
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_62 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 44467480 - 44467703
Alignment:
| Q |
17 |
atgttgctgagatatagacaaagatgcagcaactgtgttattgttgttataagtctgtggttgtggagagtgattaaagagtgcgagcgcattgaaggaa |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44467480 |
atgttgctgagatacagacaaagatgcagcaactgtgttattgttgttataagtctgtggttgtggagagtgattaaagagtgcgagcgcattgaaggaa |
44467579 |
T |
 |
| Q |
117 |
cgtgtcgccattcctaattctaactgtgaagtcacatcatcatgaggtaactgttgttggttttgttgttgcctgcaaatttcaagttgttgataaacag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44467580 |
cgtgtcgccattcctaattctaactgtgaagtcacatcatcatgaggtaactgttgttggttttgttgttgcctgcaaatttcaagttgttgataaacag |
44467679 |
T |
 |
| Q |
217 |
catgaagttcttcttccatcatcc |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44467680 |
catgaagttcttcttccatcatcc |
44467703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University