View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_65 (Length: 237)
Name: NF2097_low_65
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_65 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 165493 - 165729
Alignment:
| Q |
1 |
acaaaatcagcttgaaagatgaggagtgcaactattgataaacccttgtcaggccttaccattaatctatgtcggacttttgtttttctcaatgacaccc |
100 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | | |
|
|
| T |
165493 |
acaaaatcagcttgcaagatgagtagtgcaactattgataaacccttgtcaggccttaccattaaactatgtcggacttttgtttttctcaatgacgctc |
165592 |
T |
 |
| Q |
101 |
aataggcctttgaacaataggtgtgctagctttatcttgcattgaaactgatactcttatttcacaggttagggacaacccttctggagatttcaagagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
165593 |
aataggcctttgaacaataggtgtgctagctttatcttgcattgaaaccgatactcttatttcacaggttagggacaacccttctggagatttcaagagt |
165692 |
T |
 |
| Q |
201 |
atgtatcgtcatatttctaaaggctcgtggaccttct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
165693 |
atgtatcgtcatatttctaaaggctcgtggaccttct |
165729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 104 - 237
Target Start/End: Original strand, 104966 - 105099
Alignment:
| Q |
104 |
aggcctttgaacaataggtgtgctagctttatcttgcattgaaactgatactcttatttcacaggttagggacaacccttctggagatttcaagagtatg |
203 |
Q |
| |
|
||||||||||||||| ||||| || |||| ||||||| ||||| | ||||||||||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
104966 |
aggcctttgaacaatgtgtgtgttatctttgtcttgcaatgaaagtaatactcttatttcacaggttacagagaacccttctggagattttaagagtatg |
105065 |
T |
 |
| Q |
204 |
tatcgtcatatttctaaaggctcgtggaccttct |
237 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
105066 |
catcgtcatatttctaaaggctcatggaccttct |
105099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 151 - 237
Target Start/End: Complemental strand, 91765 - 91679
Alignment:
| Q |
151 |
atactcttatttcacaggttagggacaacccttctggagatttcaagagtatgtatcgtcatatttctaaaggctcgtggaccttct |
237 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
91765 |
atactcttatttctcaggttagcgacaacccttctggagattttaagagtatgtatcgtcatatttctaaaggttcatggaccttct |
91679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 143 - 237
Target Start/End: Original strand, 13053518 - 13053612
Alignment:
| Q |
143 |
tgaaactgatactcttatttcacaggttagggacaacccttctggagatttcaagagtatgtatcgtcatatttctaaaggctcgtggaccttct |
237 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||| |||||||| ||||||||| ||||||||||||||||||| ||||||| |||| |
|
|
| T |
13053518 |
tgaaactgatacttttatttcacaggttagagacaacccttcaggagattttaagagtatgcatcgtcatatttctaaaggtgcgtggactttct |
13053612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 156 - 237
Target Start/End: Complemental strand, 12136810 - 12136729
Alignment:
| Q |
156 |
cttatttcacaggttagggacaacccttctggagatttcaagagtatgtatcgtcatatttctaaaggctcgtggaccttct |
237 |
Q |
| |
|
|||||||| ||||| | ||||||||||| |||||||| ||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
12136810 |
cttatttcttaggttcgagacaacccttcaggagattttaagagtatgcatcgtcatatttctaaaggctcatggaccttct |
12136729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 237
Target Start/End: Complemental strand, 5688595 - 5688523
Alignment:
| Q |
165 |
caggttagggacaacccttctggagatttcaagagtatgtatcgtcatatttctaaaggctcgtggaccttct |
237 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| ||||| |||||||| || ||||| || |||||||||| |
|
|
| T |
5688595 |
caggttagggacaacccttcaggagattttgagagcatgtaccgtcatatctccaaagggtcatggaccttct |
5688523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 237
Target Start/End: Complemental strand, 5668806 - 5668733
Alignment:
| Q |
164 |
acaggttagggacaacccttctggagatttcaagagtatgtatcgtcatatttctaaaggctcgtggaccttct |
237 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| ||||| |||||||| || ||||| || |||||||||| |
|
|
| T |
5668806 |
acaggttagggacaacccttcaggagattatgagagcatgtaccgtcatatgtccaaagggtcatggaccttct |
5668733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 237
Target Start/End: Complemental strand, 5721333 - 5721261
Alignment:
| Q |
165 |
caggttagggacaacccttctggagatttcaagagtatgtatcgtcatatttctaaaggctcgtggaccttct |
237 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| ||||| |||||||| || ||||| || ||||| |||| |
|
|
| T |
5721333 |
caggttagggacaacccttcaggagattttgagagcatgtaccgtcatatctccaaagggtcatggacattct |
5721261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University