View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_68 (Length: 232)
Name: NF2097_low_68
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 96 - 175
Target Start/End: Complemental strand, 23766428 - 23766349
Alignment:
| Q |
96 |
gcacaaaaatatatatcttgatagatttcggacctcgatcattttgtaacnnnnnnncgaaaacaactcgatcattattt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23766428 |
gcacaaaaatatatatcttgatagatttcgaacctcgatcattttgtaacaaaaaaacgaaaacaactcgatcattattt |
23766349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 23766334 - 23766281
Alignment:
| Q |
160 |
aactcgatcattatttttgttaaccctcgtatataagttcttataatttggagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23766334 |
aactcgatcattatttttgttaaccctcgtatataagttcttataatttggagt |
23766281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University