View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_77 (Length: 224)
Name: NF2097_low_77
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_77 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 7007535 - 7007328
Alignment:
| Q |
14 |
cagagaaaggtagccaatttgggttgggaacaggtttggccgtgggtgctggagcaggtttggctgtggg------------tggaattggtgcacttgc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7007535 |
cagagaaaggtagccaatttgggttgggaacaggtttggccgtgggtgctggagcaggtttggctgtgggagttgttgtgggtggaattggtgcacttgc |
7007436 |
T |
 |
| Q |
102 |
attagagaaggacaacgaagctgagaaagtggagaaggattcgtactatgagcatgaagtgtaccatcatgaagttgagagtgatgcctactatgagcat |
201 |
Q |
| |
|
||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7007435 |
attagggaaggatgaggaagctgagaaagtggagaaggattcgtactatgagcatgaagtgtaccatcatgaagttgagagtgatgcctactatgagcat |
7007336 |
T |
 |
| Q |
202 |
gttgagga |
209 |
Q |
| |
|
|||||||| |
|
|
| T |
7007335 |
gttgagga |
7007328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University