View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_80 (Length: 210)
Name: NF2097_low_80
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_80 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 13 - 195
Target Start/End: Complemental strand, 5795885 - 5795702
Alignment:
| Q |
13 |
gcagagaacttgtgtagtatgaaggttatcttgagcaacatgtcctctactttcnnnnnnnggggggcatagagtgccattttattgggaagggtttgga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5795885 |
gcagagaacttgtgtagtatgaaggttatcttcagcaacatgtcctctactttctttttttggggggcatagagtgccattttattgggaagggtttgga |
5795786 |
T |
|
| Q |
113 |
aaagctttgatccgttaaaagtcgttatc-tttcttagcaaatgcttcaacgttgtttacctacaagggagaatttgttgaggt |
195 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5795785 |
aaagctttgatccgttaaaagtcattatcttttcttagcaaatgcttcaacgctgtttacctacaagggagaatttgttgaggt |
5795702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University