View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_83 (Length: 205)
Name: NF2097_low_83
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_83 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 50 - 188
Target Start/End: Complemental strand, 30054312 - 30054174
Alignment:
| Q |
50 |
tgaaactagcaccaagagctcacaagaatagaggctttgttattaggtggaccatctttatatgtgattttctatgaaccatatctgtttagtaaattat |
149 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30054312 |
tgaaaccagcaccaagagctcacaagaatagaggctttgttattaggtggaccatctttataagtgattttctatgaaccatatctgtttagtaaattat |
30054213 |
T |
|
| Q |
150 |
tattttcattattattattggtatcatctttgttattct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30054212 |
tattttcattattattattggtatcatctttgttattct |
30054174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University