View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2097_low_9 (Length: 460)
Name: NF2097_low_9
Description: NF2097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2097_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 5e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 12 - 151
Target Start/End: Original strand, 41650078 - 41650217
Alignment:
| Q |
12 |
acccaagtgtgatgttatttgattttttatcttaccgtggtgtttgttgtgttcagattgataaacttttttcatatggtgtttattacaaatgcaagaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
41650078 |
acccaagtgtgatgttatttgattttttatcttaccgtggtgtttgttgtgttcagattgataaacttttttcatatggtgttcattactaatgcaagaa |
41650177 |
T |
|
| Q |
112 |
tgactttagtgtaatcaacattacatatttggaggcatga |
151 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41650178 |
tgactttagtataatcaacattacatatttggaggcatga |
41650217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 200 - 231
Target Start/End: Original strand, 41650266 - 41650297
Alignment:
| Q |
200 |
aaactgagtgatgcgagtttgttcacaaaatc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41650266 |
aaactgagtgatgcgagtttgttcacaaaatc |
41650297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University