View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20980_high_18 (Length: 299)
Name: NF20980_high_18
Description: NF20980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20980_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 7 - 282
Target Start/End: Complemental strand, 26544220 - 26543944
Alignment:
| Q |
7 |
gatgtggctgcaattgcagtctcggtgtagttgctgaggcttcaaaatcttttatgttgtgacggcaattgctgttgcagcaatttaaaaaattatttaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26544220 |
gatgtggctgcaattgcagtctcggtgtagttgccgaggcttcaaaatcttttatgttgtgacggcaattgctgttgcagcaatttaaaaaattatttaa |
26544121 |
T |
|
| Q |
107 |
acctttatggtcttgaccaacatgaccccaagactttgtccgcgtatgttttttgtgcgccttgcactcattagtcgtgaataatattttgctgattcaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26544120 |
acctttatggtcttgaccaacatgaccccaagactttgtccgcgtatgttttttgtgcaccttgcactcattagtcgtgaataatattttgctgattcaa |
26544021 |
T |
|
| Q |
207 |
aaataaaacaacttagctaaatttcttatgttattatt-ttttaaatgattcttctgttcttattgtggtgccaact |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26544020 |
aaataaaacaacttagctaaatttcttatgttattatttttttaaatgattcttctgttcttattgtggtgccaact |
26543944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 142 - 194
Target Start/End: Complemental strand, 47620332 - 47620280
Alignment:
| Q |
142 |
ttgtccgcgtatgttttttgtgcgccttgcactcattagtcgtgaataatatt |
194 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||| | |||||||||||| |
|
|
| T |
47620332 |
ttgtccgcgaatgtcttttgtgcgccttgcactcattcgaagtgaataatatt |
47620280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 194
Target Start/End: Complemental strand, 31198742 - 31198688
Alignment:
| Q |
140 |
ctttgtccgcgtatgttttttgtgcgccttgcactcattagtcgtgaataatatt |
194 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
31198742 |
ctttgtctgcgaatgttttttgtgcgccttgcactcattcgtcgtaaataatatt |
31198688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University