View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20980_high_21 (Length: 251)

Name: NF20980_high_21
Description: NF20980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20980_high_21
NF20980_high_21
[»] chr5 (1 HSPs)
chr5 (167-236)||(34713336-34713405)


Alignment Details
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 236
Target Start/End: Complemental strand, 34713405 - 34713336
Alignment:
167 atatgttattaacttcnnnnnnnctatgttattcctagtttgacaatggacggaaaatcttatattggtc 236  Q
    ||||||||||||||||       |||||||||||||||||||||||||||||||||||||| ||||||||    
34713405 atatgttattaacttctttttttctatgttattcctagtttgacaatggacggaaaatcttctattggtc 34713336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University