View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20980_high_24 (Length: 246)
Name: NF20980_high_24
Description: NF20980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20980_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 18783503 - 18783730
Alignment:
| Q |
1 |
taatgttttttgacttaggtaattttatctgatgctaatgttcctggagaaggtgaacataaaattatgtcattcataaggaaacagcgtggtcttccgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
18783503 |
taatgttttttgacttaggtaattttatctgatgctaatgttcctggagaaggtgaacataaagttatgtcattcataaggaaacagcgtggtcttccag |
18783602 |
T |
|
| Q |
101 |
attatgatccaaacacggttcactgtctatatggatcggtaccaaatcttagnnnnnnnngttgacattgcaaatttcgtcagatatttgaaatgtttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18783603 |
attatgatccaaacacggttcactgtctatatggatcggtaccaaatcttagttttttttgttgacattgcaaatttcatcagatatttgaaatgtttga |
18783702 |
T |
|
| Q |
201 |
gataaaactttttattttgttgtgcagg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
18783703 |
gataaaactttttattttgttgtgcagg |
18783730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 18 - 139
Target Start/End: Original strand, 22872743 - 22872864
Alignment:
| Q |
18 |
ggtaattttatctgatgctaatgttcctggagaaggtgaacataaaattatgtcattcataaggaaacagcgtggtcttccggattatgatccaaacacg |
117 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||| |||||||||| |||||||||| || |||| |
|
|
| T |
22872743 |
ggtaattatatctgatgctaatgttcatggagaaggggaacataaaattatgtcattcataagcaaacaacgtggtcttcttgattatgatctaatcacg |
22872842 |
T |
|
| Q |
118 |
gttcactgtctatatggatcgg |
139 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
22872843 |
gttcactgtctatattgatcgg |
22872864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University