View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20980_high_28 (Length: 238)
Name: NF20980_high_28
Description: NF20980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20980_high_28 |
 |  |
|
| [»] scaffold0856 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0856 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 4531 - 4329
Alignment:
| Q |
17 |
catagggaggaggtagaatcttaattagaaatatgtcctagcctacaatggatgcagattgacaaagaatcggttcggcagtgggttgagttgaaacatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4531 |
catagggaggaggtagaatcttaattagaaatatgtcctagcctacaatggatgcagattgacaaagaaccggttcggcagtgggttgagttgaaacatg |
4432 |
T |
 |
| Q |
117 |
atttgtatttgatgatcatgaatccaagtgtagatgaattgtatacttaacctactacctggtcagttatctctttcaccatccgacaattgagtcaaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4431 |
atttgtatttgatgatcatgaatccaagtgtagatgaattgtatacttaacctactacctggtcagttatctctttcaccatccgacaattgagtcaaca |
4332 |
T |
 |
| Q |
217 |
tgt |
219 |
Q |
| |
|
||| |
|
|
| T |
4331 |
tgt |
4329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University