View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20980_low_25 (Length: 249)
Name: NF20980_low_25
Description: NF20980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20980_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 94 - 240
Target Start/End: Original strand, 1550369 - 1550515
Alignment:
| Q |
94 |
tcacgtttaagggatctgagtcgctcaaattttcattctccacagtataggtttgaaaattgagagtgatgatggggacaagaaatttagtatggaatgt |
193 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1550369 |
tcacgtttaagggatctgggtcgctcaaatttacattctccacagtataggtttgaaaattgagagtgatgatggggacaagaaatttagtttggaatgt |
1550468 |
T |
 |
| Q |
194 |
tactaaaaaattggccacaattggtctcattactttcactgtctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1550469 |
tactaaaaaattggccacaattggtctcattactttcactgtctctg |
1550515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University