View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20980_low_31 (Length: 237)

Name: NF20980_low_31
Description: NF20980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20980_low_31
NF20980_low_31
[»] chr1 (1 HSPs)
chr1 (1-218)||(31731766-31731983)


Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 31731766 - 31731983
Alignment:
1 attttgttttgaaaaagacaccagacattaatctattggttcaaaattgcatatttttattggtgttttgtggaccacaatatatggtggctcacatcac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
31731766 attttgttttgaaaaagacaccagacattaatctattggttcaaaattgcatatttttattggtgttttgtggaccacaatatatggtggctcccatcac 31731865  T
101 atataaacatcacatgaattaaggaggagaaaacgattggtttcgttttctgctgccaatgaatacttatagtacattctctaatcttccttcatcaaat 200  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
31731866 atataaacatcgcatgaattaaggaggagaaaacgattggtttcgttttctgctgccaatgaatacttatagtacattctctaatcttcctgcatcaaat 31731965  T
201 taattaaatggctagttg 218  Q
    ||||||||||||||||||    
31731966 taattaaatggctagttg 31731983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University