View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20981_low_3 (Length: 250)
Name: NF20981_low_3
Description: NF20981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20981_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 43915729 - 43915489
Alignment:
| Q |
1 |
acatctattgaaacattaattagaaacatgaatctgattgtgtgtctcaacttctcttgggcagccatgggagattgggcaggttcaaaacacgtctagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43915729 |
acatctattgaaacattaattagaaacatgaatctgattgtgtgtctcaacttctcttgggcagccatgggagattgggcaggttcaaaacacgtctagc |
43915630 |
T |
|
| Q |
101 |
caagtgtttcagcctcaagcaaatggtgaagaatcgtatatcaaggtccaagataccactcaatcaaatggggatgacccaactccctggtggcagaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43915629 |
caagtgtttcagcctcaagcaaatggtgaagaatcgtatatcaaggtccaagataccactcaatcaaatggggatgacccaactccctggtggcagaaga |
43915530 |
T |
|
| Q |
201 |
aaaatgtcagaatcagagagattgatgaaattgagtataat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43915529 |
aaaatgtcagaatcagagagattgatgaaattgagtataat |
43915489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University