View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20982_high_7 (Length: 339)
Name: NF20982_high_7
Description: NF20982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20982_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 9 - 324
Target Start/End: Complemental strand, 53125960 - 53125645
Alignment:
| Q |
9 |
atcataggaactcacagctatatttctagcagttagactatactgcagttttgtcatggaatacgatatacacaccttactcgatactgcaacattgggg |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53125960 |
atcacaggaactcacagctatatttctagcagttagactatactgcagttttgtcatggaatacgatatacacaccttactcgatactgcaacattgggg |
53125861 |
T |
|
| Q |
109 |
acgaccctctgggttatttatatgatacgcttcaaactgaaatccagttatatggatgctaaggacaaccttgcaatatactatgtggtaaatcctatgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53125860 |
acgaccctctgggttatttatatgatacgcttcaaactgaaatccagttatatggatgctaaggacaaccttgcaatatactatgtggtaaatcctatgt |
53125761 |
T |
|
| Q |
209 |
cttctatataaagtatgcagtctctcttgtcttagctataatctgcttactcagctgtcctgctaagcatctcacaattctctcgtcgactttatccgat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53125760 |
cttctatataaagtatgcagtctctcttgtcttagctataatctgcttactcagctgtcctgctaagcatctcacaattctctcgtcgactttatccgat |
53125661 |
T |
|
| Q |
309 |
aatttattggaaaata |
324 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
53125660 |
aatttattggaaaata |
53125645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University